Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 2576760
End position: 2576795
Length: 36

DNA sequence
>NC_009454, from 2576760 to 2576795 (36 bp); Pelotomaculum thermopropionicum SI CCTTCAGTCCGGCCTTTAGCCCGGCCTTCAGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2576574-2577506	Sequence	PTH_2458 - hypothetical protein (Protein is coded in complementary strand; from 2577506 to 2576574)