Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 238972
End position: 238995
Length: 24

DNA sequence
>NC_009454, from 238972 to 238995 (24 bp); Pelotomaculum thermopropionicum SI GGCCCTGGCCCGGGCGCTGGCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 238551-239387	Sequence	PTH_0236 TauB ABC-type nitrate/sulfonate/bicarbonate transport system, ATPase component