Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 1945269
End position: 1945292
Length: 24

DNA sequence
>NC_009454, from 1945269 to 1945292 (24 bp); Pelotomaculum thermopropionicum SI ACCCGGTCACCCGGTAACCCAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1943984-1945369	Sequence	PTH_1860 murC UDP-N-acetylmuramate--L-alanine ligase (Protein is coded in complementary strand; from 1945369 to 1943984)