Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 1615680
End position: 1615703
Length: 24

DNA sequence
>NC_009454, from 1615680 to 1615703 (24 bp); Pelotomaculum thermopropionicum SI TTCGTCCTTTGGTCCTTCCGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1615087-1616343	Sequence	PTH_1543 - hypothetical protein (Protein is coded in complementary strand; from 1616343 to 1615087)