Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 1552001
End position: 1552027
Length: 27

DNA sequence
>NC_009454, from 1552001 to 1552027 (27 bp); Pelotomaculum thermopropionicum SI ACAACCAGCACAACGAGCGCAACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1551938-1552912	Sequence	PTH_1487 DppB ABC-type dipeptide/oligopeptide/nickel transport systems, permease components (Protein is coded in complementary strand; from 1552912 to 1551938)