Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 1447264
End position: 1447317
Length: 54

DNA sequence
>NC_009454, from 1447264 to 1447317 (54 bp); Pelotomaculum thermopropionicum SI AGTTACCAAAGTTACCGTGGTTACCAAAGTTACCGTAGTTACCAAAGTTACCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1447080-1449017	Sequence	PTH_1394 - hypothetical protein (Protein is coded in complementary strand; from 1449017 to 1447080)