Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 1441688
End position: 1441711
Length: 24

DNA sequence
>NC_009454, from 1441688 to 1441711 (24 bp); Pelotomaculum thermopropionicum SI CCGCCGCTGCCGCCTCCGCCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1441267-1441923	Sequence	PTH_1389 DeoC deoxyribose-phosphate aldolase (Protein is coded in complementary strand; from 1441923 to 1441267)