Sequence retrieval

Genome: Pelotomaculum thermopropionicum SI
Start position: 1252075
End position: 1252119
Length: 45

DNA sequence
>NC_009454, from 1252075 to 1252119 (45 bp); Pelotomaculum thermopropionicum SI TGGGTCTTTGTCTTTTGGGTCTTTGTCTTTTGGGTCTTTGTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1251050-1252531	Sequence	PTH_1213 - hypothetical protein (Protein is coded in complementary strand; from 1252531 to 1251050)