Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 1779672
End position: 1779731
Length: 60

DNA sequence
>NC_009380, from 1779672 to 1779731 (60 bp); Salinispora tropica CNB-440 GTCCCAGTGTCGGCGGTCCCAGTCTCCGTGGTCCCAGTCTCCGTGGTCCCAGTGTCCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1779067-1779939	Sequence	Strop_1566 - triple helix repeat-containing collagen (Protein is coded in complementary strand; from 1779939 to 1779067)