Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 810236
End position: 810289
Length: 54

DNA sequence
>NC_009380, from 810236 to 810289 (54 bp); Salinispora tropica CNB-440 TGCTGCTGCGCCCACTGTTGCTGTTGTTCCCACTGTTGCTGTTGTTCCCACTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 809951-810454	Sequence	Strop_0726 - hypothetical protein (Protein is coded in complementary strand; from 810454 to 809951)