Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 5175586
End position: 5175639
Length: 54

DNA sequence
>NC_009380, from 5175586 to 5175639 (54 bp); Salinispora tropica CNB-440 TCCCGCCGCATCACCGCTGTCCGCCGCATCACCGCTGTCCGCCGCATCGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5175398-5176408	Sequence	Strop_4585 - hypothetical protein (Protein is coded in complementary strand; from 5176408 to 5175398)