Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4907822
End position: 4907875
Length: 54

DNA sequence
>NC_009380, from 4907822 to 4907875 (54 bp); Salinispora tropica CNB-440 GGCGCTCGTCGGCGGAGGGCCGCTCGTCGGCAGAAGGCCGCTCGTCGGCGGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4906612-4908045	Sequence	Strop_4332 - hypothetical protein (Protein is coded in complementary strand; from 4908045 to 4906612)