Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4799146
End position: 4799199
Length: 54

DNA sequence
>NC_009380, from 4799146 to 4799199 (54 bp); Salinispora tropica CNB-440 CGGTGACGGAAGCAGGGCCGGCGACGGAAGCAGGGCCGGCGACGGGAGCACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 4798295-4799152	Sequence	Strop_4232 - binding-protein-dependent transport systems inner membrane component
ORF... 4799149-4800018	Sequence	Strop_4233 - binding-protein-dependent transport system inner membrane protein