Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4296536
End position: 4296589
Length: 54

DNA sequence
>NC_009380, from 4296536 to 4296589 (54 bp); Salinispora tropica CNB-440 CGTCGTCCGATCCCGCGTCCTCGCCCGGTCCCGCGTCTCCGTCCGATCCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4295506-4298940	Sequence	Strop_3749 - UvrD/REP helicase (Protein is coded in complementary strand; from 4298940 to 4295506)