Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 5085769
End position: 5085819
Length: 51

DNA sequence
>NC_009380, from 5085769 to 5085819 (51 bp); Salinispora tropica CNB-440 GCCCGCTGACACCGCTAGCCCATGGACACCGCTAGCCCATGGACACCGCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 5085026-5085778	Sequence	Strop_4494 - LytTr DNA-binding subunit
ORF... 5085818-5086585	Sequence	Strop_4495 - hypothetical protein (Protein is coded in complementary strand; from 5086585 to 5085818)