Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4022682
End position: 4022729
Length: 48

DNA sequence
>NC_009380, from 4022682 to 4022729 (48 bp); Salinispora tropica CNB-440 ACGCCCAGCGCCACGCCCAGCGCCACGCCCAGCGCCACGCCCAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4022185-4022916	Sequence	Strop_3502 - cell wall anchor domain-containing protein