Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 5162062
End position: 5162106
Length: 45

DNA sequence
>NC_009380, from 5162062 to 5162106 (45 bp); Salinispora tropica CNB-440 GCCCTACTCGGCGATTCCCTACTCGACGATCCTCTACTCGACGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 5162096-5163553	Sequence	Strop_4574 - HDIG domain-containing protein (Protein is coded in complementary strand; from 5163553 to 5162096)