Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 3167759
End position: 3167803
Length: 45

DNA sequence
>NC_009380, from 3167759 to 3167803 (45 bp); Salinispora tropica CNB-440 GTGCCGTCGGTAGCTGTGCCGTCGGTAGCTGTGCCGTCGGTAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3165680-3174781	Sequence	Strop_2780 - beta-ketoacyl synthase (Protein is coded in complementary strand; from 3174781 to 3165680)