Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 3132536
End position: 3132580
Length: 45

DNA sequence
>NC_009380, from 3132536 to 3132580 (45 bp); Salinispora tropica CNB-440 CGACCGGGGGTGCCGCGATCGGGGGTGCCGCGATCGGGGGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3117970-3139602	Sequence	Strop_2768 - beta-ketoacyl synthase (Protein is coded in complementary strand; from 3139602 to 3117970)