Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 1834975
End position: 1835019
Length: 45

DNA sequence
>NC_009380, from 1834975 to 1835019 (45 bp); Salinispora tropica CNB-440 GTCACCGTCACCAGCCTCACCGTCACCAGGCTCACCGTCACCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1834829-1837102	Sequence	Strop_1616 - cell wall anchor domain-containing protein (Protein is coded in complementary strand; from 1837102 to 1834829)