Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 912383
End position: 912418
Length: 36

DNA sequence
>NC_009380, from 912383 to 912418 (36 bp); Salinispora tropica CNB-440 GCTGCGCTGCCTGCTCCGCTGCCTGCTCCGCCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 912085-914319	Sequence	Strop_0820 - hypothetical protein (Protein is coded in complementary strand; from 914319 to 912085)