Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 2743
End position: 2775
Length: 33

DNA sequence
>NC_009380, from 2743 to 2775 (33 bp); Salinispora tropica CNB-440 CCGTGGATAACCGGTGGATAACCGGTGGACAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2372-2842	Sequence	Strop_0002 - hypothetical protein (Protein is coded in complementary strand; from 2842 to 2372)