Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 1054243
End position: 1054272
Length: 30

DNA sequence
>NC_009380, from 1054243 to 1054272 (30 bp); Salinispora tropica CNB-440 GCGGTCGGGTCGGGTCGGGTGCGATCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1053615-1054304	Sequence	Strop_0938 - hypothetical protein (Protein is coded in complementary strand; from 1054304 to 1053615)