Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 801250
End position: 801276
Length: 27

DNA sequence
>NC_009380, from 801250 to 801276 (27 bp); Salinispora tropica CNB-440 CCGGTGTTGCCGGCGTTGCCGGCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 801149-801763	Sequence	Strop_0716 - hypothetical protein (Protein is coded in complementary strand; from 801763 to 801149)