Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4848492
End position: 4848518
Length: 27

DNA sequence
>NC_009380, from 4848492 to 4848518 (27 bp); Salinispora tropica CNB-440 CCGCCTCGACCGCCTCCACCGCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4848278-4849174	Sequence	Strop_4279 - nicotinate-nucleotide pyrophosphorylase (Protein is coded in complementary strand; from 4849174 to 4848278)