Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 3409930
End position: 3409956
Length: 27

DNA sequence
>NC_009380, from 3409930 to 3409956 (27 bp); Salinispora tropica CNB-440 CCGCCACCACCGCCATCACCGCCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3408210-3409988	Sequence	Strop_2980 - DNA-directed DNA polymerase (Protein is coded in complementary strand; from 3409988 to 3408210)