Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 3382441
End position: 3382467
Length: 27

DNA sequence
>NC_009380, from 3382441 to 3382467 (27 bp); Salinispora tropica CNB-440 GGCCGGCGCGGCCGACGCGGCCTGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3379649-3382549	Sequence	Strop_2957 - glycoside hydrolase family protein (Protein is coded in complementary strand; from 3382549 to 3379649)