Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 2991321
End position: 2991347
Length: 27

DNA sequence
>NC_009380, from 2991321 to 2991347 (27 bp); Salinispora tropica CNB-440 GCCACCTCCGCCACCGCCGCCCCCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2991192-2991932	Sequence	Strop_2656 - type 12 methyltransferase (Protein is coded in complementary strand; from 2991932 to 2991192)