Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 2633104
End position: 2633130
Length: 27

DNA sequence
>NC_009380, from 2633104 to 2633130 (27 bp); Salinispora tropica CNB-440 TCGGCGTCGTCGGTGTCGTCGGTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2633080-2634492	Sequence	Strop_2339 - cytochrome bd ubiquinol oxidase subunit I (Protein is coded in complementary strand; from 2634492 to 2633080)