Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 1685918
End position: 1685944
Length: 27

DNA sequence
>NC_009380, from 1685918 to 1685944 (27 bp); Salinispora tropica CNB-440 GTGGCCTTCGTGGCTTTCGTGGCCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1684802-1686430	Sequence	Strop_1475 - RNA polymerase sigma factor (Protein is coded in complementary strand; from 1686430 to 1684802)