Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 1320591
End position: 1320617
Length: 27

DNA sequence
>NC_009380, from 1320591 to 1320617 (27 bp); Salinispora tropica CNB-440 CCCACCGACCCGACCGACCCCACCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1319047-1320750	Sequence	Strop_1176 - regulator of chromosome condensation, RCC1