Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 3234010
End position: 3234034
Length: 25

DNA sequence
>NC_009380, from 3234010 to 3234034 (25 bp); Salinispora tropica CNB-440 CGGGCCGGTCCCGGCCGGCCCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3230154-3236678	Sequence	Strop_2821 - amino acid adenylation domain-containing protein (Protein is coded in complementary strand; from 3236678 to 3230154)