Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 1094869
End position: 1094893
Length: 25

DNA sequence
>NC_009380, from 1094869 to 1094893 (25 bp); Salinispora tropica CNB-440 GGCCCGGCCGGGCCCGGTCCGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1094482-1095075	Sequence	Strop_0974 - hypothetical protein (Protein is coded in complementary strand; from 1095075 to 1094482)