Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 858904
End position: 858927
Length: 24

DNA sequence
>NC_009380, from 858904 to 858927 (24 bp); Salinispora tropica CNB-440 GCCACCGCCCCCGCCTCCGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 858709-859473	Sequence	Strop_0774 - enoyl-CoA hydratase/isomerase (Protein is coded in complementary strand; from 859473 to 858709)