Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 721171
End position: 721194
Length: 24

DNA sequence
>NC_009380, from 721171 to 721194 (24 bp); Salinispora tropica CNB-440 CGACGGCGACGGCGTCGGTGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 720750-721526	Sequence	Strop_0638 - hypothetical protein (Protein is coded in complementary strand; from 721526 to 720750)