Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 712946
End position: 712969
Length: 24

DNA sequence
>NC_009380, from 712946 to 712969 (24 bp); Salinispora tropica CNB-440 GCCGAAGCCGAGTCCGAAGCCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 712620-713948	Sequence	Strop_0632 - major facilitator transporter (Protein is coded in complementary strand; from 713948 to 712620)