Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4880885
End position: 4880908
Length: 24

DNA sequence
>NC_009380, from 4880885 to 4880908 (24 bp); Salinispora tropica CNB-440 CAGCAGCAGGAGCACCAGCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4879290-4881305	Sequence	Strop_4308 - ATP-dependent metalloprotease FtsH (Protein is coded in complementary strand; from 4881305 to 4879290)