Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4857280
End position: 4857303
Length: 24

DNA sequence
>NC_009380, from 4857280 to 4857303 (24 bp); Salinispora tropica CNB-440 CCCCGGTCCCGGCCTCGGCTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4856682-4858202	Sequence	Strop_4287 - hypothetical protein (Protein is coded in complementary strand; from 4858202 to 4856682)