Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4823117
End position: 4823140
Length: 24

DNA sequence
>NC_009380, from 4823117 to 4823140 (24 bp); Salinispora tropica CNB-440 CACCACCACGACCACCGCCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4821924-4823180	Sequence	Strop_4253 - Pyrrolo-quinoline quinone (Protein is coded in complementary strand; from 4823180 to 4821924)