Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4730964
End position: 4730987
Length: 24

DNA sequence
>NC_009380, from 4730964 to 4730987 (24 bp); Salinispora tropica CNB-440 CGTGGTCGTGGTCGTGGTCGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4730627-4731694	Sequence	Strop_4158 - cobalamin synthesis protein, P47K (Protein is coded in complementary strand; from 4731694 to 4730627)