Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4615009
End position: 4615032
Length: 24

DNA sequence
>NC_009380, from 4615009 to 4615032 (24 bp); Salinispora tropica CNB-440 AGACGAAGACGAAGACCAGGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4614639-4615982	Sequence	Strop_4058 - NADH dehydrogenase subunit H (Protein is coded in complementary strand; from 4615982 to 4614639)