Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4493072
End position: 4493095
Length: 24

DNA sequence
>NC_009380, from 4493072 to 4493095 (24 bp); Salinispora tropica CNB-440 TCGGCGTCGGCATCGCCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4492778-4493158	Sequence	Strop_3939 - preprotein translocase subunit SecE (Protein is coded in complementary strand; from 4493158 to 4492778)