Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4251084
End position: 4251107
Length: 24

DNA sequence
>NC_009380, from 4251084 to 4251107 (24 bp); Salinispora tropica CNB-440 GCCAGCGCGAGCGCCAGGGCCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4251027-4252058	Sequence	Strop_3707 - glutamine--fructose-6-phosphate transaminase (Protein is coded in complementary strand; from 4252058 to 4251027)