Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 4156467
End position: 4156490
Length: 24

DNA sequence
>NC_009380, from 4156467 to 4156490 (24 bp); Salinispora tropica CNB-440 CGCCGACGACGACGGCGATGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4156061-4156516	Sequence	Strop_3627 - hypothetical protein (Protein is coded in complementary strand; from 4156516 to 4156061)