Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 41033
End position: 41056
Length: 24

DNA sequence
>NC_009380, from 41033 to 41056 (24 bp); Salinispora tropica CNB-440 CGGCGCCGGCCCCGGCGGCGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 39799-41100	Sequence	Strop_0032 - hypothetical protein (Protein is coded in complementary strand; from 41100 to 39799)