Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 3990509
End position: 3990532
Length: 24

DNA sequence
>NC_009380, from 3990509 to 3990532 (24 bp); Salinispora tropica CNB-440 ACGCCGCCGCCGACGTCGACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3988653-3991727	Sequence	Strop_3482 - ribonuclease (Protein is coded in complementary strand; from 3991727 to 3988653)