Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 3858926
End position: 3858949
Length: 24

DNA sequence
>NC_009380, from 3858926 to 3858949 (24 bp); Salinispora tropica CNB-440 CAGGGCGAGGGCGAGGGCCCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3856344-3859496	Sequence	Strop_3363 - non-specific serine/threonine protein kinase (Protein is coded in complementary strand; from 3859496 to 3856344)