Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 3718631
End position: 3718654
Length: 24

DNA sequence
>NC_009380, from 3718631 to 3718654 (24 bp); Salinispora tropica CNB-440 CTGTCGTGCTGTTGTGCTGTTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3717837-3718694	Sequence	Strop_3241 - hypothetical protein (Protein is coded in complementary strand; from 3718694 to 3717837)