Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 3106273
End position: 3106296
Length: 24

DNA sequence
>NC_009380, from 3106273 to 3106296 (24 bp); Salinispora tropica CNB-440 GCCACCGCCAACGCCACCGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3105244-3107808	Sequence	Strop_2759 - hypothetical protein (Protein is coded in complementary strand; from 3107808 to 3105244)