Sequence retrieval

Genome: Salinispora tropica CNB-440
Start position: 3066945
End position: 3066968
Length: 24

DNA sequence
>NC_009380, from 3066945 to 3066968 (24 bp); Salinispora tropica CNB-440 CGATCAGTGGATCAGTGGATCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3066965-3068305	Sequence	Strop_2722 - hypothetical protein (Protein is coded in complementary strand; from 3068305 to 3066965)